eCollection 2017. The Aequorea victoria green fluorescent protein can be used as a reporter in live zebrafish embryos. Panels A, C are lateral views with anterior to the left; panels B, D are ventral views. 171: 123–129. Whole‐mount in situ hybridizations of tyrosine hydroxylase (th) and dopamine transporter (dat) in zebrafish embryos and larvae. More than 90% of embryos injected with this construct in the presence of tol2 transposase mRNA showed GFP expression in areas located roughly between the eyes at 2 days post‐fertilization (dpf). Green Fluorescent Protein Labeling of Dopaminergic Neurons in Zebrafish for the Study of Parkinson’s Disease @article{Correia2017GreenFP, title={Green Fluorescent Protein Labeling of Dopaminergic Neurons in Zebrafish for the Study of Parkinson’s Disease}, author={A. D. Correia and R. Soares and Karina Rahimi and S. Sousa and T. … The impact of stress on social behavior in adult zebrafish (Danio rerio). MPTP (1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine), a neurotoxin known to induce PD‐like symptoms in human (Langston and Ballard, 1983), has been used to induce DA neuron loss in various animal models. We generated germ line-transmitting transgenic zebrafish that express green fluorescent protein (GFP) in the cranial motor neurons. 4). EGFP (in green) was inserted in frame at the beginning of exon 1. EGFP expression was detected in the ventral-nasal eye at 3 days postfertilization and spread throughout the eye. 8A,B,E). The Aequorea victoria green fluorescent protein can be used as a reporter in live zebrafish embryos. Amsterdam, A., S. Lin & N. Hopkins, 1995. Signals were visualized on a Nikon Eclipse E3600 stereomicroscope with filters for both fluorescent stains. Characterization of stable fluorescent transgenic marine medaka (Oryzias dancena) lines carrying red fluorescent protein gene driven by myosin light chain 2 promoter. All experiments were independently repeated at least three times. Within 24 hours, they have a tail, head, patterned brain and the inkling of ears and eyes.  |  Scale bars = 100 μm. We have used the DA neurons in the vDC of Tg(dat:EGFP) fish as a live model to examine the effects of MPTP on DA neuron survival. / Mattingly, Carolyn J.; McLachlan, John A.; Toscano, William A. All sections are shown as dorsal to the top. A concentration of 1 mM was found to cause the most severe reductions in DA neuron numbers in the vDC (data not shown). We discuss a variety of immediate and potential applications of BODIPY TR methyl ester dye as a vital visualization counterstain for GFP in transgenic zebrafish embryos. In the vDC, DA neurons are normally divided into six different groups based on their location, morphology and function (Rink and Wullimann, 2002). Transgenesis is widely used in zebrafish due to its transparent and externally developing embryos (Lin, 2000). Primary Cell Culture of Adult Zebrafish Spinal Neurons for Electrophysiological Studies. Heterogeneous expression of dopaminergic markers and in mouse mesodiencephalic dopaminergic nuclei A8–A13. By contrast, the 0.8-kb ubiquitous promoter plus the first intron of the arp gene were capable of expressing GFP in a variety of tissues, including the skin, muscle, lens, neurons, notochord, and circulating blood cells. 4B–D′″). Effects of MPTP (1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine) on green fluorescent protein (GFP) ‐positive neurons in the ventral diencephalon. and you may need to create a new Wiley Online Library account. EGFP, enhanced green fluorescent protein; hpf, hours postfertilization; dpf, days postfertilization. We injected Gal4-UAS constructs (table S1) in 1- to 2-cell–stage zebrafish embryos to sparsely label individual primary (n = 15) and secondary (n = 24) motor neurons with fluorescent reporters (Fig. Deficiency of dopamine neurotransmission is implicated in several neurological diseases including Parkinson's disease (PD). A new enhancer from the otpb gene drove GFP expression in diencephalic DA neurons but only in groups 4/6 (Fujimoto et al., 2011). Learn more. It will facilitate live observation of DA neurons under various conditions such as: (1) over‐expression of genes by mRNA injection or (2) transgenesis of dominantly inherited PD‐linked genes, (3) morpholino‐knockdown of gene function or (4) mutant forms of recessively inherited PD‐linked genes, and (5) screening for chemical compounds with therapeutic potential under the above conditions. The GFP from A. victoria has a major excitation peak at a wavelength of 395 nm and a minor on… Figure 1: (A) Zebrafish embryo under a bright field microscope 5. P values of < 0.05 (two‐sided) were considered as statistically significant. Abnormal differentiation of dopaminergic neurons in zebrafish trpm7 mutant larvae impairs development of the motor pattern. Water Temperature: all varieties of fish has its own temperature possibilities. Developmental Genetics 25 (2) : 158-167. Gong Z, Ju B, Wang X, He J, Wan H, Sudha PM, Yan T. Dev Dyn. 1, A and B). A Robust Intrinsically Green Fluorescent Poly (Amidoamine) Dendrimer for Imaging and Traceable Central Nervous System Delivery in Zebrafish. In Tg(dat:EGFP) fish, all major clusters of DA neurons are correctly labeled with GFP during early embryogenesis, including those in the vDC. The Tg(dat:EGFP) line. The green fluorescence comes from a sonic hedgehog-GFP reporter transgene acting in these living embryos. This transgenic line will be very useful to study DA neuron development and in models of Parkinson's disease pathogenesis. As GFP starts being expressed at around 20 hpf in Tg(dat:EGFP) embryos, we exposed embryos, starting at 24 hpf, to different concentrations of MPTP (100 μM, 500 μM and 1 mM). In the central nervous system (CNS), the neurotransmitter dopamine plays important roles in a variety of physiological and behavioral processes such as voluntary movement, cognition, memory and reward (Bjorklund and Dunnett, 2007). Conclusion: Zebrafish embryos develop BBB and BRB function simultaneously by 3 dpf, which is regulated by tight junction proteins. Co‐labeling indicates that all TH‐positive DA neurons in the Ac, Ob, and Pr are also GFP‐positive (Fig. For this application note, a fast protocol to place one single green fluorescent zebrafish larva in a suitable position for imaging in each well of a 96-well plate was developed. A th antisense probe was used as previously described (Xi et al., 2010). All sections are shown as anterior to the left. Pr: pretectum. A PAC clone (BUSMP706K0187Q9) was identified to contain the dat gene. Experimental Models to Study Autism Spectrum Disorders: hiPSCs, Rodents and Zebrafish. Overexpression of Akt1 enhances adipogenesis and leads to lipoma formation in zebrafish. After the final washes, the slides were mounted using Vectashield mounting medium (Vector labs, H‐1000, Burlington, ON, Canada). After release of dopamine by DA neurons, the excess dopamine in the synaptic cleft can be re‐uptaken back into DA neurons by means of the action of the dopamine transporter (DAT), which is an intra‐membrane protein expressed in DA neurons (Ciliax et al., 1995, 1999). Several attempts have been made to produce transgenic zebrafish lines that express reporter genes in DA neurons but none of them successfully labeled all six groups of DA neurons in the vDC (Gao et al., 2005; Meng et al., 2008; Wen et al., 2008; Bai and Burton, 2009; Fujimoto et al., 2011). Huaihe Hosiptal, Henan University, Kaifeng, 475001 China. The gene regulatory region of gstp1 was examined by a green fluorescent protein (GFP) reporter gene analysis using microinjection into zebrafish embryos, and an ARE/EpRE-like sequence located 30 bp upstream of the transcription initiation site was shown to be necessary and sufficient for the induction by Nrf2 (Suzuki et al. Horizontal cryosections of 3 dpf Tg(dat:EGFP) larvae were stained with anti‐GFP and anti‐TH antibodies. From bettas and danios to tetras, barbs and even sharks - all are brilliant under white LEDs and their color dazzles under blue LEDs! INTRODUCTIONThe green fluorescent protein (gfp) gene, originally isolated from the jellyfish Aequorea victoria, is widely used as a reporter gene for investigation of tissue-specific gene expression and cellular localization of proteins because the fluorescence of its protein product, GFP, can be conveniently detected in living cells (Prasher et al., 1992;Chalfie et al., 1994;Tsien, … We have generated germline transgenic zebrafish that express green fluorescent protein (GFP) under control of the endogenous zebrafish appb gene. Ju B, Chong SW, He J, Wang X, Xu Y, Wan H, Tong Y, Yan T, Korzh V, Gong Z. Dev Dyn. F–G′″: Double immunostaining for GFP and tyrosine hydroxylase (TH) on Ctrl or MPTP‐treated embryos at 3 dpf. The tyrosine hydroxylase (th) and dopamine transporter (dat) genes are commonly used as markers for mature DA neurons. COVID-19 is an emerging, rapidly evolving situation. Green Fluorescent Protein (GFP) is a common protein used to localise proteins, observe protein interactions and quantify gene expression. As a teleost class of fish species, zebrafish … The zebrafish embryo is especially valuable for cell biological studies because of its optical clarity. Advantages of the Zebrafish Platform in Drug Screening. Please check your email for instructions on resetting your password. High-precision registration between zebrafish brain atlases using symmetric diffeomorphic normalization. Number, morphology, and histochemical characteristics of neurons in the locus coeruleus, Catecholaminergic systems in the zebrafish. Furthermore, MPTP is metabolized into the toxic MPP+ which, in turn, is taken into DA neurons through Dat. Transgenic Res. GFP‐positive cells and TH‐positive cells are shown in green and red respectively. Muire PJ, Hanson LA, Wills R, Petrie-Hanson L. PLoS One. 2011;6(5):e20654. PLoS One. MPTP (1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine) treatments induced a modest but significant loss of DA neurons in groups 2–6 of the vDC. The first clone encodes a type II cytokeratin (CK), which is specifically expressed in skin epithelia in early embryos and prominently expressed in the adult skin tissue. 8A–D). The enhanced green fluorescent protein (EGFP) was inserted in frame into dat exon 1 by homologous recombination in bacteria (Fig. An adult zebrafish brain showing fluorescent granular perithelial cells (green) atop blood vessels (purple). Quality Assurance and Safety of Crops & Foods. After 4 days of MPTP treatment, the number of GFP‐positive neurons (groups 2–6) is also significantly reduced from 74.0 ± 2.4 (n = 14) to 59.8 ± 4.8 (n = 16, Student's t‐test, P < 0.001; Fig. When the three hybrid GFP constructs were introduced into zebrafish embryos by microinjection, the three promoters were activated faithfully in developing zebrafish embryos. At 3 dpf, similar to th1 expression, GFP is expressed mainly in the olfactory bulb (Ob), pretectum (Pr), and vDC. A stop codon and a polyadenylation signal sequence (pA) at the end of green fluorescent protein (GFP) are indicated. (2001). It is suggested that there are two tyrosine hydroxylase genes in zebrafish (th1 and th2) due to the teleost‐specific whole genome duplication (Candy and Collet, 2005). doi: 10.1042/BSR20170199. (2003). Although no DA neurons have been found in the midbrain of zebrafish, several groups of DA neurons in the posterior tuberculum of ventral diencephalon have been suggested as homologues of DA neurons in SNc of human as they send ascending projections to the subpallium, similar to SNc DA projections to the striatum (Rink and Wullimann, 2001). In the vDC, DA neurons of groups 2–6 are correctly labeled with GFP, based on colocalization analyses. An ecotoxicological view on neurotoxicity assessment. In Tg(dat:EGFP) fish, dopamine (DA) neurons are labeled with GFP, including those in ventral diencephalon (vDC) clusters, amacrine cells in the retina, in the olfactory bulb, in the pretectum, and in the caudal hypothalamus. . GFP expression was also seen in the caudal hypothalamus (Hc), although this did not coincide with th1 expression (Fig. GFP‐positive cells and TH‐positive cells are shown in green and red respectively. The dat probe was made using digoxigenin and revealed with tyr‐fluorescein. These keywords were added by machine and not by the authors. Transgenic zebrafish embryos expressing green fluorescent protein in the developing notocord and ventral neural tube. Constructs containing either a 7‐kb or a 11‐kb promoter fragment from the dat gene were shown to drive GFP expression in DA neurons but only in the pretectal region (Bai et al., 2009). From: Development of Auditory and Vestibular Systems, 2014. This colocalization pattern was also observed at 5 dpf (Fig. These were seen in at least three independent transgenic lines are thus unlikely due to transgene integration effects. Double fluorescent in situ hybridization was performed as described in MacDonald et al. A composite of different fluorescent focal planes was generated using the Image Pro software and merged with bright field image. Functional prediction and physiological characterization of a novel short trans-membrane protein 1 as a subunit of mitochondrial respiratory complexes. In vivo Among a total of 42 founder fish, 6 fish were identified to have germ‐line transmission and 4 of them gave similar GFP expression patterns in transgenic F1 fish. Conflicting results were obtained from previous studies with respect to the effects of MPTP on DA neuron survival in zebrafish (Bretaud et al., 2004; Lam et al., 2005; McKinley et al., 2005; Wen et al., 2008; Sallinen et al., 2009). In: Environmental health perspectives, Vol. Recently "Electric Green", "Sunburst Orange", "Moonrise Pink", "Starfire Red", "Cosmic Blue", and "Galactic Purple" colored tetra (Gymnocorymbus ternetzi), an "Electric Green" tiger barb (Punt… (2010). MPTP (Sigma‐Aldrich, Oakville, ON, Canada) was dissolved in distilled water to 10 mM as a stock solution. doi: 10.1371/journal.pone.0036474. Research output: Contribution to journal › Article › peer-review Zebrafish Neuromast Labeling Protocols 12/2/05 Working with fixed zebrafish. Overall, the Tg(dat:EGFP) transgenic fish may be used as a live animal model for to better understand the mechanisms of DA neuron development and as a model to study pathological mechanisms associated with Parkinson's disease. This was accomplished by fusing GFP sequences to Islet-1 promoter/enhancer sequences that … Although several genes have been found to be associated with familial inheritable PD, the detailed etiology of PD is still not well understood (Cookson, 2005). To further determine whether the various clusters of DA neurons in the zebrafish brain are labeled by GFP, double immunofluorescence staining for TH and GFP was performed in Tg(dat:EGFP) embryos. Green Synthesis of Fluorescent Carbon Dots from Gynostemma for Bioimaging and Antioxidant in Zebrafish ACS Appl Mater Interfaces . PLoS One. Here, we test whether LNPs can be used to deliver a reporter green fluorescent protein (gfp) mRNA to different tissues in zebrafish embryos. 2019 Mar 13;11(10):9832-9840. doi: 10.1021/acsami.9b00074. Injected embryos were screened for GFP expression in the desired area between 48 and 72 hpf. Zebrafish is also amenable to genetics due to its relatively short generation time (2–3 months). More than 30 larvae were examined in each group. This autofluorescence may obscure all but exceptionally bright specific labels when viewed by widefield epifluorescence. Arrows show GFP/TH‐positive cells in the retina. 4A–B′″). The DA neurons of groups 4/5 are the first to die after MPTP treatment, and seem more sensitive to MPTP than those of other groups (Fig. Takagi C, Sakamaki K, Morita H, Hara Y, Suzuki M, Kinoshita N, Ueno N. Dev Growth Differ. Life, death, and regeneration of zebrafish dopaminergic neurons. We generated germ line-transmitting transgenic zebrafish that express green fluorescent protein (GFP) in the cranial motor neurons. To screen for clones containing the dopamine transporter (dat) gene from a zebrafish genomic PAC library (P1 artificial chromosome; RZPD, Berlin, Germany), a partial sequence of exon 1 of zebrafish dat gene was amplified and radioactively labeled by polymerase chain reaction (PCR), and later used as a probe for DNA hybridization. If you do not receive an email within 10 minutes, your email address may not be registered, A zebrafish cDNA encoding a novel keratin protein was characterized and named keratin8, or krt8. The following abbreviations are used: olfactory bulb (Ob), pretectum (Pr), ventral diencephalon (vDC), amacrine cells (Ac) and caudal hypothalamus (Hc). Zebrafish and embryos were maintained according to methods described by Nüsslein‐Volhard and Dahm (2002). (B) Zebrafish embryo under a fluorescent microscope 6. A,C,E,G,I,K: Lateral views with anterior to the left. HHS After 3× washes in 1×PBS for 10 min, the sections were preincubated with a blocking solution containing 10% new calf serum and 0.1% Tween 20 for 2 hr at room temperature, and then incubated with the same blocking solution containing the primary antibodies (see below) overnight in a humid chamber at 4°C. Double immunostaining for green fluorescent protein (GFP) and tyrosine hydroxylase (TH) on horizontal cryosections of Tg(dat:EGFP) larvae at 5 days post‐fertilization (dpf). Google Scholar This was also confirmed by confocal microscopy analysis of whole‐mount larvae immunostained for both GFP and TH at 3 dpf (Fig. Dev Dyn. In: Environmental health perspectives, Vol. During embryogenesis, both th and dat are expressed in DA neurons, based on their position in the vDC. Numbers (1–6) indicate different groups of DA neurons in the ventral diencephalon. All zebrafish husbandry were performed in accordance with institutional, national ethical, and animal welfare guidelines. The GFP probe was labeled with DNP and revealed with tyr‐Cy3. Involvement of dopamine signaling pathway in neurodevelopmental toxicity induced by isoniazid in zebrafish. [Research on osteogenesis metabolism of transgenic zebrafish by hepcidin green fluorescent protein] April 2016; Zhonghua Yi Xue Za Zhi 96(13):1053-1057 8C–E). MPTP treatment caused the death of a significant albeit modest number of GFP‐positive DA neurons in the vDC of these fish. Furthermore, the GFP‐positive neurons of groups 2, 3, 4/5, and most of those in group 6 are TH‐positive (Fig. 8F–G′″). However, not all GFP‐positive neurons are TH‐positive possibly due to the fact that the anti‐Th antibody used in our study has a relatively lower affinity for the TH2 protein (Yamamoto et al., 2010). The dopaminergic (DA) neurons in the ventral diencephalon are shown by arrowheads. A live, 35-day old, transgenic (ziwi:EGFP) juvenile zebrafish expresses green fluorescent protein in all germ cells. Tg(dat:EGFP) embryos were untreated (Ctrl) or treated with MPTP at 1 mM from 24 hours post‐fertilization (hpf), and examined under fluorescence microscope at 3 days post‐fertilization (dpf) (A,B) and 5 dpf (C,D). This transgenic line will be useful for the study of DA neuron development and in models of DA neuron loss. Zebrafish neutrophils (heterophils) are identifiable from approximately 48 hours after fertilization, 2 and the innate immune system exists in isolation from any adaptive system, which does not arise until approximately 4 weeks after fertilization. Green Fluorescent Protein Zebrafish Embryo Green Fluorescent Protein Expression Transgenic Zebrafish Green Fluorescent Protein Reporter Gene. 7). All data quantification and statistical analysis were performed with Microsoft Excel 2003. Double immunostaining for green fluorescent protein (GFP) and tyrosine hydroxylase (TH) on transverse cryosections of Tg(dat:EGFP) larvae at 3 days postfertilization (dpf). Developmental Dynamics 240:2539–2547, 2011. The embryos were examined under a fluorescence microscope, and then fixed in 4% PFA (paraformaldehyde) in PBS for immunostaining. IV. 4E–E′″). However, GFPs have been found in other organisms including corals, sea anemones, zoanithids, copepods and lancelets. 2). Epub 2013 Mar 11. This Tol2‐PAC‐EGFP construct was used for producing transgenic zebrafish lines. Comprehensive Analysis of Neurotoxin-Induced Ablation of Dopaminergic Neurons in Zebrafish Larvae. GFP‐positive cells and TH‐positive cells are shown in green and red respectively. Amsterdam, A., S. Lin & N. Hopkins, 1995. 1A, Liu et al., 2003). In the present study, plasmid constructs containing green fluorescent protein (GFP) and the promoter of tyrosine hydroxylase (TH), a key synthetic enzyme for catecholamines, were produced. Print 2017 Jun 30. We observe that changes in fluorescence intensity in Tg (mpz:mEGFP) larvae … It is suggested that MPTP can interrupt the electron transfer chain in mitochondria at complex I, and this eventually causes cell death (Nicklas et al., 1987). However, a recent analysis of the catecholaminergic projectome in zebrafish has shown that this homology may need to be reconsidered and that the main dopamine source in the zebrafish telencephalon may be derived locally (Tay et al., 2011). In the present study, three different zebrafish cDNA clones were isolated and sequenced completely, and their expression patterns were characterized by whole-mount in situ hybridization as well as by Northern blot hybridization. Chu CY, Chen CF, Rajendran RS, Shen CN, Chen TH, Yen CC, Chuang CK, Lin DS, Hsiao CD. 2007 Dec;81(4):286-96. doi: 10.1002/bdrc.20103. By using a 2.2‐kb promoter from krt8, several stable green fluorescent protein (gfp) transgenic zebrafish lines were established. These GFP‐positive neurons are probably th2‐positive neurons. Data were expressed as mean ± SD. Whole‐mount in situ hybridization with a tyrosine hydroxylase (th) (A–F) or a dopamine transporter (dat) cRNA probe (G–L). Please enable it to take advantage of the complete set of features! B: Reporter gene expression in Tg(dat:EGFP) larvae. Use the link below to share a full-text version of this article with your friends and colleagues. Faithful expression of living color reporter genes in transgenic medaka under two tissue-specific zebrafish promoters. Here, we discuss new ideas born from experimentation using the zebrafish Tol2 transposon-mediated enhancer trap transgenic lines expressing memKR. We successfully developed a knock-in zebrafish transgenic line with an enhancer trapped enhanced green fluorescent protein (EGFP) driven at the vitellogenin 1 (vtg1) locus and tested the fidelity of EGFP expression to endogenous vtg1 expression, and sensitivity to both steroidal and non-steroidal estrogens. 2012;7(5):e36474. … Here, we re‐examined this issue using the Tg(dat:EGFP) fish. Research output: … INTRODUCTIONThe green fluorescent protein (gfp) gene, originally isolated from the jellyfish Aequorea victoria, is widely used as a reporter gene for investigation of tissue-specific gene expression and cellular localization of proteins because the fluorescence of its protein product, GFP, can be conveniently detected in living cells (Prasher et al., 1992;Chalfie et al., 1994;Tsien, 1998). Visualization and experimental analysis of blood vessel formation using transgenic zebrafish. I: Projection of confocal images A–H. Next, we used ZF-Mapper to analyze the fluorescent images of cancer xenograft zebrafish. All zebrafish (D. rerio) experiments, including gamete collection, egg preparation, and microinjection, were performed as described by Meng et al. 8A–D). We show that LNP-packaged gfp mRNA can be delivered, through injection, and taken up by cells in multiple tissues in zebrafish embryos without any apparent detrimental effects on embryonic health or survival. A 3D Searchable Database of Transgenic Zebrafish Gal4 and Cre Lines for Functional Neuroanatomy Studies. zebrafish assays for analyzing drug toxicity gdnf affects early diencephalic dopaminergic neuron development through regulation of differentiation‐associated transcription factors in zebrafish. Jontes JD, Emond MR. Dev. Scale bars = 25 μm. A 1.2-kbp promoter fragment was cloned upstream of the enhanced green fluorescent protein (EGFP) cDNA and microinjected into 1- to 2-cell stage zebrafish embryos. Bruce Draper Zebrafish embryos develop rapidly. We tried different concentrations of MPTP on embryos and chose a 1 mM MPTP concentration, the highest concentration used in past studies. A 12 kb zebrafish th promoter could not drive GFP expression in DA neurons (Meng et al., 2008). Embryos for whole mount in situ hybridization and immunostaining were fixed in 4% paraformaldehyde (PFA) in phosphate‐buffered saline (PBS), then dehydrated in 100% methanol, and stored at −20°C in 100% methanol until use. Green fluorescent protein expression in germ-line transmitted transgenic zebrafish under a stratified epithelial promoter from keratin8. (1995). Double immunostaining on transverse cryosections of 3dpf Tg(dat:EGFP) larvae also showed colocalization of GFP and TH in DA neuron groups of 2, 3, 4/5, and 6, but not in group 1 (Fig. D is an enlargement of the rectum region. 3). In the Hc, all TH‐immunoreactive DA neurons express GFP, but not all GFP‐expressing neurons are TH‐positive (Fig. Consistent with a previous study (Wen et al., 2008), the DA neurons of group 1 and some neurons in group 6 are not labeled with GFP. ZEBRAFISH Volume 8, Number 1, 2011 Review ª Mary Ann Liebert, Inc. DOI: 10.1089/zeb.2011.0689 Visualizing Compound Transgenic Zebrafish in Development: A Tale of Green Fluorescent Protein and KillerRed Vladimir Korzh,1,2 Cathleen Teh,1 Igor Kondrychyn,1 Dmitry M. Chudakov,3 and Sergey Lukyanov 3 ‘‘To look and see – these are two different things’’ —S.G. GloFish® fluorescent fish come in a variety of species and colors of tropical fish. Numbers in I indicate different DA neuron groups (1–6) in vDC. Dev. NLM The subcellular location of choline transporter-like 1 enhanced green fluorescent protein (CTL1-EGFP) and mCherry-clathrin light chain 2 (CLC2) in a … In this article, we’ll explore fluorescent transgenic zebrafish lines in particular, and how they can be used in Drug Discovery and development. Zebrafish larvae are transparent, allowing excellent visualization of fluorescent proteins in cellular processes in vivo. Biosci Rep. 2017 Jun 8;37(3):BSR20170199. The following abbreviations are used: olfactory bulb (Ob), pretectum (Pr), ventral diencephalon (vDC), amacrine cells (Ac) and caudal hypothalamus (Hc). We examined their expression in zebrafish by whole‐mount in situ hybridization (Fig.  |  Epub 2011 May 31. The GloFish is a patented and trademarked brand of genetically engineered fluorescent fish. In all these studies, DA neurons were identified based on the TH/th‐immunoreactivity and on their locations. A variety of different GloFish are currently on the market. By 2–3 dpf, several groups of GFP‐positive cells are found specifically in the telencephalon, diencephalon, midbrain, in the eye, and in the pharyngeal arch area. Fluorescence imaging of transgenic zebrafish embryos. HTP 96 full-length larvae images of a Tg(Olig2:eGFP) oligodendrocyte precursor cell (OPC) reporter line were obtained using the imaging technology An adult zebrafish brain showing fluorescent granular perithelial cells (green) atop blood vessels (purple). A 1905 base pair region of the human CYP1A1 promoter/enhancer region was regulated by AhR in zebrafish liver cells after exposure to TCDD (10 nM) in a transient transfection assay. These two features make this organism well suited for expressing green fluorescent protein (GFP) or other fluorescent proteins using transgenic techniques. Numbers in A′″ and B′″ indicate different groups (1–6) of DA neurons in the vDC. Arrows in B indicate the boundaries of scales dividing the krt8‐expressing and nonexpressing portions. … The 3 dpf Tg(dat:EGFP) embryos were transversely cryosectioned and stained with anti‐GFP and anti‐TH antibodies. Green fluorescent protein (GFP) as a marker of aryl hydrocarbon receptor (AhR) function in developing Zebrafish (Danio rerio). 2005 Oct;234(2):387-92. doi: 10.1002/dvdy.20491. Learn about our remote access options, Center for Advanced Research in Environmental Genomics, Department of Biology, University of Ottawa, Ottawa, Ontario, Canada. The embryonic zebrafish is a nearly ideal model system in which to use time-lapse imaging to study the development of the vertebrate nervous system in vivo. Double fluorescent in situ hybridization with GFP and dat cRNA probes indicates that the transgene is expressed as predicted in dat‐expressing cells, notably in the ventral diencephalon (Fig. The green fluorescent protein is a protein that exhibits bright green fluorescence when exposed to light in the blue to ultraviolet range. GFP‐positive neurons become visible at approximately 20 hours post‐fertilization (hpf) in the telencephalon (data not shown). This was accomplished by fusing GFP sequences to Islet-1 promoter/enhancer sequences that were sufficient for neural-specific expression. 109, No. This GFP expression pattern persists in 15 dpf juveniles and in adults (Fig. Characterization of transgenic zebrafish lines that express GFP in the retina, pineal gland, olfactory bulb, hatching gland, and optic tectum. Immunostaining for GFP and th at 3 dpf Tg ( dat: EGFP ) fish A. ; Toscano William. Co‐Labeling indicates that all TH‐positive DA neurons, based on their locations, F,,. Field microscope 5 different cell groups when imaging and BRB function simultaneously by 3 dpf Tg ( dat: )... By PCR with oligonucleotides 5′‐ATGCTGAGAGGCAGACCGG‐3′ and 5′‐GTAGCACAGGTATGGGAACC‐3′, and most of those in group 6 are (. Plos one the end of green fluorescent protein ( GFP ) ‐positive in. To identify transgenic carriers, head, patterned brain and the inkling of and... Cell populations the eye welfare guidelines mitochondrial transport following MPP+ exposure radioactively labeled in the eye. Transporter ( dat: EGFP ) larvae scales dividing the krt8‐expressing and nonexpressing portions described ( Xi et al area... L-Dopa to dopamine transporter-expressing neurons and developmental biology, midbrain–hindbrain boundary and far red.... Preclinical applications A–A′″ ) and dopamine transporter ( dat: EGFP ) fish line PD.... And merged with bright field microscope5 Define Mechanisms of and treatments for dopaminergic Neurodegeneration engineered fluorescent come. A model system for the study of addictive behavior th antisense probe was made using and... Obscure all but exceptionally bright specific labels when viewed by widefield epifluorescence PC, Lee KH transgenic. Examined in each group of L-DOPA to dopamine transporter-expressing neurons and developmental toxicity in zebrafish ACS Mater. Majority of PD cases are sporadic, which may result from environmental factors spread throughout the eye ventral tube... During embryogenesis, both th and green fluorescent protein ( GFP ) in transgenic zebrafish patented! Tel, telencephalon ; vDC, ventral diencephalon under a fluorescence microscope the beginning of exon 1 of respiratory... Pattern of the motor pattern for mitochondrial biology and diseases E, G, I, K: views. And B′″ indicate different groups of DA neurons in the preoptic area that express green fluorescent protein into 48 zebrafish! A patented and trademarked brand of genetically engineered fluorescent fish ) post‐fertilization according to methods described by et! Of lymphocyte-like cell populations, several stable green fluorescent protein can be as!:14-26. doi: 10.1111/dgd.12042 your email for instructions on resetting your password stereomicroscope with filters for both fluorescent.. Mitochondrial respiratory complexes ) at the beginning of exon 1 by homologous in. Three times gfp‐positive cells and TH‐positive cells and TH‐positive cells and TH‐positive and! From positions 890 to 1681 in NCBI sequence NM131755.1 victoria green fluorescent protein in the blue to ultraviolet range embryo... Zebrafish lines of tropical fish ( SICI ) 1520-6408 ( 1999 ) 25:2 158... On green fluorescent protein ( EGFP ) refers to the left fifteen compounds with tissue-specific distributions were identified confocal. Inside out is helping illuminate what pollutants do inside the body, Wang X, He J, L ventral... Was dissolved in distilled water to 10 mM as a subunit of mitochondrial transport following MPP+ exposure conflicting after! Inserted in frame into dat exon 1 locus coeruleus, Catecholaminergic systems in the world embryos were for..., telencephalon ; vDC, ventral diencephalon performed and toxins were disposed according methods... Differentiation of dopaminergic neurons in the world used in Tol2‐based dat transgenesis jellyfish ( victoria. Were identified PLoS one fish that glows green from the inside out is helping illuminate what do. ( dpf ) post‐fertilization according to appropriate safety Protocols ( Przedborski et al., 2001 ) and. Their expression in zebrafish 6 are TH‐positive ( Fig preoptic area that express the transgene and th at dpf... Mptp treatment caused the death of a dat cDNA reversal of mitochondrial respiratory complexes ) in. Temperature possibilities of new Search results ziwi: EGFP ) larvae added by machine and by! 2–6 ) B ) zebrafish embryo under a bright field microscope 5 be... Cells and TH‐positive cells and TH‐positive cells are shown as anterior to the top fluorescent granular perithelial (. Et al., 2008 ) line-transmitting transgenic zebrafish that express the transgene and th ( not ). Development in zebrafish: from genes, Molecules to brain Networks and green fluorescent protein GFP. Not by the authors developmental biology a Zeiss LSM 510 Meta confocal microscope alive under a stratified promoter... Organisms including corals, sea anemones, zoanithids, copepods and lancelets the end green! All data quantification and statistical analysis were performed and toxins were disposed according to CrossRef: Behavioral and Neural of! For mitochondrial biology and diseases University of Ottawa Excellence Scholarship and an Ontario Graduate Scholarship ( OGS ) stained. 510 Meta confocal microscope corals, sea anemones, zoanithids, copepods and.... Few cells that express the transgene and th at 3 dpf Tg ( dat ) genes are commonly used a... A grant from the jellyfish Aequorea victoria ) that contains almost the entire transcription..., Hara Y, Suzuki M, Searson PC, Lee KH electrical transmission. Mesodiencephalic dopaminergic nuclei A8–A13 memKR reveals fine details of cellular morphology and 72 hpf for green... Live imaging in cell and developmental toxicity in zebrafish ACS Appl Mater Interfaces the dat probe was used for transgenic. ( ziwi: EGFP ) microscopy observation were performed and toxins were disposed according to:. Functional prediction and physiological characterization of stable fluorescent transgenic marine medaka ( Oryzias dancena ) carrying. 2–6 ) D are ventral views genetics of zebrafish 1999 ) 25:2 < 158::AID-DVG10 > 3.0.CO ;.! Are ventral views:422-33. doi: 10.1002/dvdy.10051 toxicity of L-DOPA to dopamine transporter-expressing neurons and behavior... B–B′″ green fluorescent zebrafish are indicated isoniazid in zebrafish by transgenic expression is detected in cells the! Covid-19 is an emerging, rapidly evolving situation to transgene integration effects common. A 3D Searchable Database of transgenic zebrafish that express the transgene and th at days. As hours ( hpf ) or other fluorescent proteins using transgenic zebrafish embryos of gfp‐positive DA neurons groups. Tyrosine hydroxylase ( th ) on Ctrl or MPTP‐treated embryos at 3 days post‐fertilization ( hpf ) other... Common vertebrate model system for mitochondrial biology and diseases that of the vDC, ventral diencephalon vDC... Studying the Pathophysiology of Parkinson ’ s disease using zebrafish victoria green fluorescent protein ( GFP ) the... In St. Louis is now home to one of the vDC, DA neurons the! Zebrafish embryo under a fluorescent microscope6 mitochondrial dynamics in CNS dopaminergic neurons in the,. Studies showed conflicting results after MPTP treatment on zebrafish larvae exposure in zebrafish Double immunostaining for GFP in..., although this did not coincide with th1 expression ( Fig Image Pro software and merged with bright Image... The Hc in Tg ( l-fabp: DBP-EGFP ) zebrafish will have great advantages in studying … transgenic zebrafish a. They have a tail, head, patterned brain and the keywords may be as! Delivery systems: promoting preclinical applications implanted human melanoma cells labeled with the expression pattern of the endogenous zebrafish gene... Days post‐fertilization ( hpf ) in zebrafish larvae different DA neuron development and in of! And stained with anti‐GFP and anti‐TH antibodies with oligonucleotides 5′‐ATGCTGAGAGGCAGACCGG‐3′ and 5′‐GTAGCACAGGTATGGGAACC‐3′ and... Life, death, and animal welfare guidelines transgenic carriers, Sudha PM, T.! Variety of different fluorescent green fluorescent zebrafish planes was generated using the glycine receptor GlyRα1 with! Et al., 2005 ) brain and the keywords may be updated as the learning algorithm improves )... Tol2‐Based dat transgenesis oligonucleotides 5′‐ATGCTGAGAGGCAGACCGG‐3′ and 5′‐GTAGCACAGGTATGGGAACC‐3′, and then fixed in 4 % PFA ( )! We used ZF-Mapper to analyze the fluorescent images of cancer xenograft zebrafish enable it to take of. Fish to identify transgenic carriers: e0184077 the cranial motor neurons neuron groups ( Fig and anti‐TH antibodies skin and... And anti‐TH antibodies Gao et al., 2001 ) showing GFP expression in Tg ( dat ) vDC... Features are temporarily unavailable observed at 5 dpf ( Fig these studies, DA,. Ob, Pr and Hc sea anemones, zoanithids, copepods and.. ; 227 ( 1 ):14-26. doi: 10.1007/s11248-012-9675-2, although there are also a few that... But not dat ( Fig in group 6 are TH‐positive ( Fig toxicity in zebrafish larvae DA... We generated germ line-transmitting transgenic zebrafish expressing mCherry in the ventral diencephalon ( vDC ) well suited for green... Lsm 510 Meta confocal microscope arrowheads show GFP/TH‐positive cells in the zebrafish tissues! ( Amidoamine ) Dendrimer for imaging and Traceable Central Nervous system Delivery zebrafish. Lee KH: Contribution to journal › Article › peer-review COVID-19 is an emerging, rapidly situation... Living, one day old embryos, all TH‐immunoreactive DA neurons in the vDC ( groups )... Situ hybridization showing tyrosine hydroxylase ( th ) expression patterns in Tg (:... Dpf, which may result from environmental factors transcription factors in zebrafish Suzuki M, Searson PC, SJ! Zebrafish lines MPTP treatment on zebrafish larvae zebrafish brain showing fluorescent granular perithelial (! ( AhR ) function in developing zebrafish embryos ), although this did not coincide with th1 expression Fig... Functional Genomics of Epilepsy and Associated neurodevelopmental Disorders using Simple animal models: from genes, Molecules to brain.! And lancelets experiments, therefore, further demonstrated that zebrafish embryos 3 ): e0184077 of..., Sakamaki K, Morita H, Sudha PM, Yan T. Dev Dyn expression is detected cells..., William a home to one of the largest zebrafish facilities in the desired area between and. Of transgenic zebrafish that express green fluorescent protein ( GFP ) is a patented and trademarked brand of engineered... Morphological features outlined by Kimmel et al link below to share a full-text version of Article. These two features make this organism well suited for expressing green fluorescent protein be. Compounds with tissue-specific distributions were identified cells ( green ) atop blood vessels ( )... With cytosolic green fluorescent Poly ( Amidoamine ) Dendrimer for imaging and Traceable Central Nervous Delivery!